ktrnascan_se

 

Function

Finds tRNA genes using tRNAscan-SE

Description

ktrnascan_se detects transfer RNA genes in DNA sequence utilizing tRNAscan-SE. tRNAscan-SE identifies 99–100% of transfer RNA genes in DNA sequence while giving less than one false positive per 15 gigabases.

ktrnascan_se utilizes tRNAscan-SE server provided by Lowe Lab. Original web-service is located at the following URL:

http://lowelab.ucsc.edu/tRNAscan-SE/

This tools is a subset of Keio Bioinformatics Web Service (KBWS) package, which contains interfaces to bioinformatics web services through a proxy server at Keio University. ktrnascan_se is thus an interface of "runtRNAscan" method included in KBWS SOAP service. This method can be alternatively accessed directly from programming languages as SOAP web service. Please refer to the KBWS online documentations http://soap.g-language.org/kbws/ for more information.

Usage


   Here is a sample session with ktrnascan_se

% ktrnascan_se
Finds tRNA genes using tRNAscan-SE
Input (gapped) sequence(s): refseq:NC_000908
Output file [nc_000908.ktrnascan_se]: 
Jobid: kbws_4760102
*****


tRNAscan-SE v.1.21 (Oct 2000) - scan sequences for transfer RNAs

Please cite:
     Lowe, T.M. & Eddy, S.R. (1997) "tRNAscan-SE: A program for
     improved detection of transfer RNA genes in genomic sequence"
     Nucl. Acids Res. 25: 955-964.

  This program uses a modified, optimized version of tRNAscan v1.3
  (Fichant & Burks, J. Mol. Biol. 1991, 220: 659-671),
  a new implementation of a multistep weight matrix algorithm
  for identification of eukaryotic tRNA promoter regions
  (Pavesi et al., Nucl. Acids Res. 1994, 22: 1247-1256),
  as well as the RNA covariance analysis package Cove v.2.4.2
  (Eddy & Durbin, Nucl. Acids Res. 1994, 22: 2079-2088).

  Cove-predicted tRNA secondary structures rendered by 
  NAVIEW (c) 1988 Robert E. Bruccoleri.



Results

Sequence        Your-seq
Subsequence     Your-seq.t1 257160 257233

Sequence        Your-seq.t1
Source          Your-seq
Brief_identification tRNA-Cys
Transcript tRNA "TGC Cys C"
Score tRNAscan-SE-1.21 56.59

Sequence        Your-seq
Subsequence     Your-seq.t2 257271 257344

Sequence        Your-seq.t2
Source          Your-seq
Brief_identification tRNA-Pro
Transcript tRNA "CCA Pro P"
Score tRNAscan-SE-1.21 79.30

Sequence        Your-seq
Subsequence     Your-seq.t3 257351 257424

Sequence        Your-seq.t3
Source          Your-seq
Brief_identification tRNA-Met
Transcript tRNA "ATG Met M"
Score tRNAscan-SE-1.21 76.46

Sequence        Your-seq
Subsequence     Your-seq.t4 257447 257520

Sequence        Your-seq.t4
Source          Your-seq
Brief_identification tRNA-Met
Transcript tRNA "ATG Met M"
Score tRNAscan-SE-1.21 75.25

Sequence        Your-seq
Subsequence     Your-seq.t5 257561 257649
Sequence        Your-seq.t5
Source          Your-seq
Brief_identification tRNA-Ser
Transcript tRNA "TCA Ser S"
Score tRNAscan-SE-1.21 59.71

Sequence        Your-seq
Subsequence     Your-seq.t6 257666 257739

Sequence        Your-seq.t6
Source          Your-seq
Brief_identification tRNA-Met
Transcript tRNA "ATG Met M"
Score tRNAscan-SE-1.21 71.85

Sequence        Your-seq
Subsequence     Your-seq.t7 257744 257814

Sequence        Your-seq.t7
Source          Your-seq
Brief_identification tRNA-Asp
Transcript tRNA "GAC Asp D"
Score tRNAscan-SE-1.21 58.26

Sequence        Your-seq
Subsequence     Your-seq.t8 257820 257892

Sequence        Your-seq.t8
Source          Your-seq
Brief_identification tRNA-Phe
Transcript tRNA "TTC Phe F"
Score tRNAscan-SE-1.21 74.07

Sequence        Your-seq
Subsequence     Your-seq.t9 266425 266498

Sequence        Your-seq.t9
Source          Your-seq
Brief_identification tRNA-Arg
Transcript tRNA "CGC Arg R"
Score tRNAscan-SE-1.21 67.11

Sequence        Your-seq
Subsequence     Your-seq.t10 306619 306690

Sequence        Your-seq.t10
Source          Your-seq
Brief_identification tRNA-Arg
Transcript tRNA "AGG Arg R"
Score tRNAscan-SE-1.21 56.90



Run Statistics:

Started: Mon Jan  4 23:05:56 PST 2010

------------------------------------------------------------
Search Mode:                 General
Searching with:              tRNAscan + EufindtRNA -> Cove
Covariance model:            TRNA2.cm
tRNAscan parameters:         Strict
EufindtRNA parameters:       Relaxed (Int Cutoff= -32.1)

Pseudogene checking disabled
Reporting HMM/2' structure score breakdown
------------------------------------------------------------

First-pass (tRNAscan/EufindtRNA) Stats:
---------------
Sequences read:         1
Seqs w/at least 1 hit:  1
Bases read:             580078 (x2 for both strands)
Bases in tRNAs:         3088
tRNAs predicted:        39
Av. tRNA length:        79
Script CPU time:        0.08 s
Scan CPU time:          0.39 s
Scan speed:             2974.8 Kbp/sec

First pass search(es) ended: Mon Jan  4 23:05:57 PST 2010

Cove Stats:
-----------
Candidate tRNAs read:     39
Cove-confirmed tRNAs:     36
Bases scanned by covels:  3634
% seq scanned by covels:  0.3 %
Script CPU time:          0.09 s
Cove CPU time:            5.84 s
Scan speed:               622.3 bp/sec

Cove analysis of tRNAs ended: Mon Jan  4 23:06:03 PST 2010

Summary
--------
Overall scan speed: 181274.4 bp/sec

tRNAs decoding Standard 20 AA:              35
Selenocysteine tRNAs (TCA):                 1
Possible suppressor tRNAs (CTA,TTA):        0
tRNAs with undetermined/unknown isotypes:   0
Predicted pseudogenes:                      0
                                            -------
Total tRNAs:                                36

tRNAs with introns:             0

|

Isotype / Anticodon Counts:

Ala   : 1         AGC:         GGC:         CGC:         TGC:       
Gly   : 2         ACC:         GCC:         CCC:         TCC:       
Pro   : 1         AGG:         GGG:         CGG:         TGG:       
Thr   : 3         AGT:         GGT:         CGT:         TGT:       
Val   : 1         AAC:         GAC:         CAC:         TAC:       
Ser   : 4         AGA:         GGA:         CGA:         TGA:         ACT:         GCT:       
Arg   : 4         ACG:         GCG:         CCG:         TCG:         CCT:         TCT:       
Leu   : 4         AAG:         GAG:         CAG:         TAG:         CAA:         TAA:       
Phe   : 1         AAA:         GAA:                                 
Asn   : 1         ATT:         GTT:                                 
Lys   : 2                                   CTT:         TTT:       
Asp   : 1         ATC:         GTC:                                 
Glu   : 1                                   CTC:         TTC:       
His   : 1         ATG:         GTG:                                 
Gln   : 1                                   CTG:         TTG:       
Ile   : 1         AAT:         GAT:                      TAT:       
Met   : 3                                   CAT:                    
Tyr   : 1         ATA:         GTA:                                 
Supres: 0                                   CTA:         TTA:       
Cys   : 1         ACA:         GCA:                                 
Trp   : 1                                   CCA:                    
SelCys: 1                                                TCA:       



Predicted tRNA Secondary Structures:
Your-seq.trna1 (257160-257233)  Length: 74 bp
Type: Cys       Codon: TGC at 36-38 (257195-257197)     Score: 56.59
HMM Sc=22.52    Sec struct Sc=34.07
         *    |    *    |    *    |    *    |    *    |    *    |    *    |   
Seq: GGTGCCTTAGCCAAGTGGActcAAGGCCTGGAGCTGCAACCTCCATAtCGTCAGTTCGAATCTGACAGGCACCT
Str: >>>>>>>..>>>............>>>>.......>>>>.......<<<<<<<<<<<<.

Your-seq.trna2 (257271-257344)  Length: 74 bp
Type: Pro       Codon: CCA at 35-37 (257305-257307)     Score: 79.30
HMM Sc=55.47    Sec struct Sc=23.83
         *    |    *    |    *    |    *    |    *    |    *    |    *    |   
Seq: CGGGAAGTAGCTTAGTTtGGTAGAGCACTTGGTTTGGGACCAAGGGGtCGCAGGTTCAAATCCTGTCTTCCCGA
Str: >>>>>>>..>>>>.........>>>>.......>>>>.......<<<<<<<<<<<<.

Your-seq.trna3 (257351-257424)  Length: 74 bp
Type: Met       Codon: ATG at 35-37 (257385-257387)     Score: 76.46
HMM Sc=43.95    Sec struct Sc=32.51
         *    |    *    |    *    |    *    |    *    |    *    |    *    |   
Seq: GGCTGGATACCTCAGTTGGTtAGAGGGCCCGGTTCATACCCGGGTTGtCGTGAGTTCGAGTCTCACTCCAGCCA
Str: >>>>>>>..>>>>.........>>>>.......>>>>.......<<<<<<<<<<<<.

Your-seq.trna4 (257447-257520)  Length: 74 bp
Type: Met       Codon: ATG at 35-37 (257481-257483)     Score: 75.25
HMM Sc=53.91    Sec struct Sc=21.34
         *    |    *    |    *    |    *    |    *    |    *    |    *    |   
Seq: GGATCTATAGCTCAATTGGTtAGAGCCCCCGACTCATAATCGGTCTGtTACAGGTTCAAGTCCTGTTAGATCCA
Str: >>>>>>>..>>>>.........>>>.......>>>>.......<<<<<<<<<<<<.

Your-seq.trna5 (257561-257649)  Length: 89 bp
Type: Ser       Codon: TCA at 35-37 (257595-257597)     Score: 59.71
HMM Sc=24.23    Sec struct Sc=35.48
         *    |    *    |    *    |    *    |    *    |    *    |    *    |    *    |    *   
Seq: GGAGACTTACCCAAGCGGCtgAAGGGTTCGGTCTTGAAAACCGAGAgGTGCTTTATAAGCACGCGAGGGTTCGAATCCCTCAGTCTCCG
Str: >>>>>>>..>>>...........>>>>.......>>>>>...>>>>.......<<<<<<<<<<<<.

Your-seq.trna6 (257666-257739)  Length: 74 bp
Type: Met       Codon: ATG at 35-37 (257700-257702)     Score: 71.85
HMM Sc=46.39    Sec struct Sc=25.46
         *    |    *    |    *    |    *    |    *    |    *    |    *    |   
Seq: CGCGGGATAGAGCAGTTGGTcAGCTCGTCAGGCTCATAATCTGAAGGtCGAGGGTTCAAATCCCTCTCCCGCAA
Str: .>>>>>>..>>>>.........>>>>.......>>>>.......<<<<<<<<<<<..

Your-seq.trna7 (257744-257814)  Length: 71 bp
Type: Asp       Codon: GAC at 33-35 (257776-257778)     Score: 58.26
HMM Sc=34.50    Sec struct Sc=23.76
         *    |    *    |    *    |    *    |    *    |    *    |    *    |
Seq: GGTTCCATGGTGTAGTGATAACATATCTCCCTGTCACGGAGGGGtTGCGGGTTTGATTCCCGTTGGAACCG
Str: >>>>>>>..>>>>.......>>>>.......>>>>.......<<<<<<<<<<<<.

Your-seq.trna8 (257820-257892)  Length: 73 bp
Type: Phe       Codon: TTC at 34-36 (257853-257855)     Score: 74.07
HMM Sc=46.53    Sec struct Sc=27.54
         *    |    *    |    *    |    *    |    *    |    *    |    *    |  
Seq: GGTCTTGTAGCTCAGTCGGTAGAGCAACGGTCTGAAGAACCGTGTGtCGGCAGTTCGATTCTGCCCGAGACCA
Str: >>>>>>>..>>>>........>>>>.......>>>>.......<<<<<<<<<<<<.

Your-seq.trna9 (266425-266498)  Length: 74 bp
Type: Arg       Codon: CGC at 35-37 (266459-266461)     Score: 67.11
HMM Sc=43.38    Sec struct Sc=23.73
         *    |    *    |    *    |    *    |    *    |    *    |    *    |   
Seq: GTCATCATAGCTCAATAGGAcAGAGTATCAGCTTGCGGAGCTGAGGGtTACAGGTTCGATTCCTGTTGGTGACG
Str: >>>>>>>..>>>>.........>>>>.......>>>>.......<<<<<<<<<<<<.

Your-seq.trna10 (306619-306690) Length: 72 bp
Type: Arg       Codon: AGG at 34-36 (306652-306654)     Score: 56.90
HMM Sc=22.17    Sec struct Sc=34.73
         *    |    *    |    *    |    *    |    *    |    *    |    *    | 
Seq: CTTCCCTTGGTGCAATGGAcAGCACAACTGAGTCCTAATCAGTAAATAGAGGTTCAACTCCTCTAGGGAAGG
Str: >>>>>>>..>>>>........>>>>.......>>>>.......<<<<<<<<<<<<.


Candidate tRNAs not verified by Cove analysis:
>Your-seq.t1 (Fp Hit: 199996-200090, 95 bp, Src: Eu) 
ATCACCTTACCCTTTGCTTTAGTGCAAGCATTTGCTGTGATCCAAATTGCTACTAATGCA
GGCACTGGTTCAAGTCCGATTAGTTTAGCTAATAG
>Your-seq.t2 (Fp Hit: 222067-222172, 106 bp, Src: Eu) 
CCTTTTAAAGGCTTTGGTTTAACTGGTAATGCCCCTACTGATTGGAATGAGATCAAAGGT
AAAGTTCCAGTAGAAGTAGTTCAATCCCCCCATTCCCCCAACCTCT
>Your-seq.t36 (Fp Hit: 99482-99280, 203 bp, Src: Eu) 
TTTTTTAACAATGCTACTGTAGTTGGTAAAGCAATTGCAGTAGTACCAAAAGCACCAGAT
ATTGACAAGCAGATAGTAGTTATTGTACTTAATTTCATATGTTAAGAGAAAAGTTATGAA
TTTATAAAGAGAGCAAACTTAAACAGCCAATAAGGATCTTATTAGTTGTTGATAAGTTCA
AATCAAAAGGTTTTATCTCTAAA



Command line arguments

Qualifier Type Description Allowed values Default
Standard (Mandatory) qualifiers
[-seqall]
(Parameter 1)
seqall Nucleotide sequence(s) filename and optional format, or reference (input USA) Readable sequence(s) 2
[-outfile]
(Parameter 2)
outfile Output file name Output file <*>.ktrnascan_se
Additional (Optional) qualifiers
-title string title of your job Any string  
-mode string search mode Any string Default
-source string training data set Any string Mixed (general tRNA model)
-gcode string Genetic Code for tRNA Isotype Prediction Any string  
-pesudogene boolean Disable pseudo gene checking Boolean value Yes/No No
-origin boolean Show origin of first-pass hits Boolean value Yes/No No
-ace boolean Display results in ACeDB format Boolean value Yes/No No
-codons boolean Show codons instead of tRNA anticodons Boolean value Yes/No No
-fpos boolean Show false positives from tRNAscan/EufindtRNA Boolean value Yes/No No
-breakdown boolean Show primary and secondary structure components to Cove scores Boolean value Yes/No No
-covescore string Cove score cutoff Any string  
-euparams string EufindtRNA search parameters Any string Default
-euscore string Intermediate score cutoff Any string  
Advanced (Unprompted) qualifiers
(none)

Input file format

ktrnascan-se can use any genome sequence data that seqret can read.

Output file format

The output from ktrnascan_se is general output format of tRNAscan-SE.

Data files

None.

Notes

None.

References


   Lowe, T.M., and Eddy, S.R., tRNAscan-SE: a program for improved detection
      of transfer RNA genes in genomic sequence, Nucleic Acids Research, 25, 955-964.


Warnings

None.

Diagnostic Error Messages

None.

Exit status

It always exits with a status of 0.

Known bugs

None.

See also

Program name Description
seqret Reads and writes (returns) sequences

Author(s)

Kazuki Oshita (cory @ g-language.org) Institute for Advanced Biosciences, Keio University 252-8520 Japan

History

2009 - Written by Kazuki Oshita

Target users

This program is intended to be used by everyone and everything, from naive users to embedded scripts.

Comments