ktcoffee

Function

Multiple sequence alignment using T-COFFEE

Description

ktcoffee computes a multiple sequence alignment utilizing T-Coffee. T-Coffee is a multiple sequence alignment package. T-Coffee is able to align Protein, DNA and RNA sequences or to combine the output of several alignment methods (Clustal, Mafft, Muscle, Probcons...).

ktcoffee utilizes T-Coffee SOAP server provided by EBI (European Bioinformatics Institute).Original web-service is located at the following URL:

http://www.ebi.ac.uk/Tools/webservices/services/msa/tcoffee_soap

This tools is a subset of Keio Bioinformatics Web Service (KBWS) package, which contains interfaces to bioinformatics web services through a proxy server at Keio University. ktcoffee is thus an interface of "runTcoffee" method included in KBWS SOAP service.
This method can be alternatively accessed directly from programming languages as SOAP web service. Please refer to the KBWS online documentations http://www.g-language.org/kbws/ for more information.

Usage


   Here is a sample session with ktcoffee

% ktcoffee
Multiple sequence alignment using T-COFFEE
Input (gapped) sequence(s): multiNuc.fasta
Output file [test0.ktcoffee]:
Dendrogram (tree file) from T-Coffee output file [test0.dnd]:
(aligned) output sequence set [test0.aln]:

	  

Command line arguments

Qualifier Type Description Allowed values Default
Standard (Mandatory) qualifiers
[-sequence]
(Parameter 1)
seqall (Gapped) sequence(s) filename and optional format, or reference (input USA) Readable sequence(s) Required
[-outfile]
(Parameter 2)
outfile Output file name Output file <*>.ktcoffee
[-dndoutfile]
(Parameter 3)
outfile Dendrogram (tree file) from T-Coffee output file Output file <*>.dnd
[-alnoutfile]
(Parameter 4)
outfile (aligned) output sequence set Output file <*>.aln
Additional (Optional) qualifiers
-matrix string Scoring matrix to use (blosum or pam) Any string
-outorder string Sequence order in output alignment (aligned or input) Any string aligned
Advanced (Unprompted) qualifiers
(none)

Input file format

Input files for usage example

File: multiNuc.fasta

>test0
taagttattatttagttaatacttttaacaatattattaaggtatttaaaaaatactatt
atagtatttaacatagttaaataccttccttaatactgttaaattatattcaatcaatac
atatataatattattaaaatacttgataagtattatttagatattagacaaatactaatt
ttatattgctttaatacttaataaatactacttatgtattaagtaaatattactgtaata
ctaataacaatattattacaatatgctagaataatattgctagtatcaataattactaat
atagtattaggaaaataccataataatatttctacataatactaagttaatactatgtgt
agaataataaataatcagattaaaaaaattttatttatctgaaacatatttaatcaattg
>testA
taatgtgaatgaatttccaagaataaggtttaatgaaaaaaacgatttaagtgaatttaa
tcaattcaaaataaattattcacttttagtaaaaggcattaaaaaaatttttcactcagt
ttcaaataatcgtgaaatatcttctaaatttaatggagtaaatttcaatggatccaatgg
tttttccaaacaaaatataagcacgatattcaactgtgccaattgataaaaaaggttgaa
caattcattctgttgcattttcaatgtttaaatgtttgatctcgtcagcactattaacta
ttgtttctttactaagaagagaagaattgacagttagaaatctattttgttttaatcatt
>testB
aacaaaaaatcaataccgcaataaaaaagttgcattactttactaattttaactgctaaa
ttttcttgttccttattcaaaaaaaagcgttctgcctttgcccctttattgagattagaa
cgaaaatcactattattagttgtatgtaaagcacctataactttattgttcacaacaata
actcttaccgattcacctttagagcaagtaatgtatttttgcacaattgcttgttgatta
tattataacaattttaatttaaccaaaatacccctcgaattttaacagtttttataatca
>testC
ttttcttacctaaagaagctgaagttattcaagcagattttttagagtatgatactaaag
aacgacaactaaatgaatgacaaaaactaattgttaaagcatttagtgaaaatatcttct
cttttcaaaagaaaattgaagaacaacaattgaaaaatcaattagaaattcaaactaaat
acaataaaatatcaggaaaaaagattgatcttttaactactgcagttgttttatgtgcac
ttagtgaacaaaaggcacataatactgataaaccacttttaattagtgaggcattgttga
ttatggatcattattcacaaggtgctgaaaaaaaacaaactcatgctttattagataagc
>testD
tgatgaagaattgggtactgatgatgaagacttttacttaaaaggagcgatgcaaaactt
tagttatgtgaactatgtttcaccattaaaagtaatatctgatccaagtactggaatagt
cagttccaaaaagaataatgctgaaatgaaaagtaaacaaatgtcaactgatcaaatgac
tagtgaaaaagaatttgattattacactgaaacacttaaagcattattagagaaagaaga
tagtgcagaattaaatgaaaatgaaaaaaaactagttgaaaccattaagaaagcttacac
>testE
gcttgcattactaaattaagagtaacagttaaaaaccctgaacttgttaatgaaactatt
attaaagacttgggagcagctggggtaatgcgtaccactccaacattctttgtagcagtg
tttggtactcgagctgctgtttataaatcagcaatgcaagatattatccaaggcaaagta
aattgaacagagttgcaaaaagtcttagataaaaatgatagtactgttgaaaaaccagaa
ataaaaccaaccccagttttaaaagttcaagatgaaattgtgatcctctcaccagttaat
>testF
aagtcttgctggctttgatactccttttagtccagataacctccagtatttagaaaaaga
aactgattatgatcagaactttaaaagttttactgaaaagtttaaagatgaaaaaataac
taacaaccaacttggtattgttgatatctataacttattcagtggttttcacaagagtgt
cttcccagttgatgatgcttttgttaaattacctaaagtacctactgaattatttaagtt
agttgatgataatgtctttcctaagttaaatcctaagggcttaaatatctctgataatat
>testI
tttatttcaaactttttgttagcaatttgtgcataaacatgattatcagctaagaactgc
tgaaacttattttgactgtttactgttcataaatttaaaggtaagttaagttttttgatc
atttggggatacttttcatatattttggttcatgggtggaggaattgacaaatcttttgg
attctagctgtactaattgtttcaaactgttttttagtccaaaataaaaaaccttttttg
taactattatctaaatcataaactttttgcaaagattcaaagttaaaggatgaaaacaag
atttgagataaaaacaattgatccacatatcaaaccaaacaaagcaatggataaacaaat
>testJ
taatgaaggataactaccatcatttgctcttttatatggaagaggttgaccccaaccaat
tgaactttctttagcttccttttgaagtttaatgtagttgttagcacgatcaacaattgc
ttgttctagtttttctatattagctaaatctgttctaaagttattaagtttattagcagc
tttaatataagactcataacttgattttatttgtgaaagtgaattattaaaatcttgttg
ttttttaatagtttcagataaattggtattgttttttaaaagttttttagctaaatcaca
tacatctttttgaccgttattattagaagttccattttctaacatagttgttaaagctgt
	  

Output file format

Output files for usage example

File: test0.dnd

(
(
(
(
test0:0.10475,
testA:0.08525)
:0.00297,
testC:0.09203)
:0.00406,
(
testD:0.10000,
(
testE:0.11071,
testF:0.09929)
:0.00500)
:0.00781)
:0.00094,
(
testB:0.08417,
testJ:0.09583)
:0.00312,
testI:0.09187);
	  

Data files

None.

Notes

None.

References

      Notredam, C., et al.,(2000) T-Coffee: A novel method for fast and accurate
      multiple sequence alignment, 302(1), 205-217.
    

Warnings

None.

Diagnostic Error Messages

None.

Exit status

It always exits with a status of 0.

Known bugs

None.

See also

Program name Description
emma Multiple sequence alignment (ClustalW wrapper)
kclustalw Multiple sequence alignment using ClustalW 2
kkalign Multiple sequence alignment using Kalign
kmafft Multiple sequence alignment using MAFFT
kmuscle Multiple sequence alignment using MUSCLE
seqret Reads and writes (returns) sequences

Author(s)

Kazuki Oshita (cory @ g-language.org)
Institute for Advanced Biosciences, Keio University
252-8520 Japan

History

2009 - Written by Kazuki Oshita
Mar 2013 - Update document by Kazuki Oshita

Target users

This program is intended to be used by everyone and everything, from naive users to embedded scripts.

Comments

None.