krnafold

Function

Predicts secondary structure of single starnd RNA or DNA using RNAfold

Description

krnafold predicts on RNA 2D structure from given RNA or DNA sequences utilizing RNAfold.
RNAfold reads RNA sequences, calculates their minimum free energy (mfe) structure and predicts the mfe structure in bracket notation and its free energy.

krnafold utilizing RNAfold web server produced by Institute for Theoretical Chemistry. original web-services is located at the follwing URL:

http://rna.tbi.univie.ac.at/cgi-bin/RNAfold.cgi

This tools is a subset of Keio Bioinformatics Web Service (KBWS) package, which contains interfaces to bioinformatics web services through a proxy server at Keio University. kblast is thus an interface of "runRNAfold" method included in KBWS SOAP service.
This method can be alternatively accessed directly from programming languages as SOAP web service. Please refer to the KBWS online documentations http://www.g-language.org/kbws/ for more information.

Usage


  Here is a sample session with krnafold

% krnafold
Predicts secondary structure of single starnd RNA or DNA sequence using RNAfold
Input (gapped) sequence(s): test_sequence.fasta
RNAfold output [test_sequence.krnafold]: stdout
Minimum free energy (MFE) structure in Ct format [test_sequence.ct]: 
Minimum free energy (MFE) structure in Vienna format [test_sequence.vienna]:

>test_sequenc
GGGCUAUUAGCUCAGUUGGUUAGAGCGCACCCCUGAUAAGGGUGAGGUCGCUGAUUCGAAUUCAGCAUAGCCC
(((((((..(((.((((.(....(((((.(((((....)))).)..).))))....).)))).)))))))))) (-28.20)
(((((((..(((.((((.(....((((({(((((....))))})..,,))))....).)))).)))))))))) [-29.60]
(((((((..(((.((((.(....((((.(..(((....))).).....))))....).)))).)))))))))) {-18.80 d=11.19}
frequency of mfe structure in ensemble 0.103122; ensemble diversity 16.38 

	  

Command line arguments

Qualifier Type Description Allowed values Default
Standard (Mandatory) qualifiers
[-seqall]
(Parameter 1)
seqall Readable sequence(s) Required
[-outfile]
(Parameter 2)
outfile RNAfold output Output file <*>.krnafold
[-ctfile]
(Parameter 3)
outfile minimum free energy (MFE) structure in Ct format Output file <*>.ct
[-viennafile]
(Parameter 4)
outfile minimum free energy (MFE) structure in Vienna format Output file <*>.vienna
Additional (Optional) qualifiers
-method string p: minimum free energy (MFE) and protein function mfe: minimum free energy (MFE) only Any string p
-noclosegu boolean no GU pairs at the end of helices Boolean value Yes/No No
-[no]nolp boolean avoid isolated base pairs Boolean value Yes/No Yes
-dangling string d1: no dangling end energies d2: unpaired bases can participate in at most one dangling end (MFE folding only) d3: dangling energies on both sides of a helix in any case d4: allow coaxial stacking of adjacent helices n multi-loops (MFE folding only) Any string d2
-param string rna: RNA parameters (Turner model) andronescu: RNA parameters (Andronescu model) dna: DNA parameters Any string rna
-tmp integer rescale energy parameters to given temperature (C) Any integer value 37
-circ boolean assume RNA molecule to be circular Boolean value Yes/No No
Advanced (Unprompted) qualifiers
(none)

Input file format

krnafold can use any genome sequence data that seqret can read.

Output file format

Output files for usage example

File: test_sequence.ct

73 ENERGY =   -28.2    1
	      1 G       0    2   73    1
	      2 G       1    3   72    2
	      3 G       2    4   71    3
	      4 C       3    5   70    4
	      5 U       4    6   69    5
	      6 A       5    7   68    6
	      7 U       6    8   67    7
	      8 U       7    9    0    8
	      9 A       8   10    0    9
	      10 G       9   11   66   10
	      11 C      10   12   65   11
	      12 U      11   13   64   12
	      13 C      12   14    0   13
	      14 A      13   15   62   14
	      15 G      14   16   61   15
	      16 U      15   17   60   16
	      17 U      16   18   59   17
	      18 G      17   19    0   18
	      19 G      18   20   57   19
	      20 U      19   21    0   20
	      21 U      20   22    0   21
	      22 A      21   23    0   22
	      23 G      22   24    0   23
	      24 A      23   25   52   24
	      25 G      24   26   51   25
	      26 C      25   27   50   26
	      27 G      26   28   49   27
	      28 C      27   29   47   28
	      29 A      28   30    0   29
	      30 C      29   31   44   30
	      31 C      30   32   42   31
	      32 C      31   33   41   32
	      33 C      32   34   40   33
	      34 U      33   35   39   34
	      35 G      34   36    0   35
	      36 A      35   37    0   36
	      37 U      36   38    0   37
	      38 A      37   39    0   38
	      39 A      38   40   34   39
	      40 G      39   41   33   40
	      41 G      40   42   32   41
	      42 G      41   43   31   42
	      43 U      42   44    0   43
	      44 G      43   45   30   44
	      45 A      44   46    0   45
	      46 G      45   47    0   46
	      47 G      46   48   28   47
	      48 U      47   49    0   48
	      49 C      48   50   27   49
	      50 G      49   51   26   50
	      51 C      50   52   25   51
	      52 U      51   53   24   52
	      53 G      52   54    0   53
	      54 A      53   55    0   54
	      55 U      54   56    0   55
	      56 U      55   57    0   56
	      57 C      56   58   19   57
	      58 G      57   59    0   58
	      59 A      58   60   17   59
	      60 A      59   61   16   60
	      61 U      60   62   15   61
	      62 U      61   63   14   62
	      63 C      62   64    0   63
	      64 A      63   65   12   64
	      65 G      64   66   11   65
	      66 C      65   67   10   66
	      67 A      66   68    7   67
	      68 U      67   69    6   68
	      69 A      68   70    5   69
	      70 G      69   71    4   70
	      71 C      70   72    3   71
	      72 C      71   73    2   72
	      73 C      72    0    1   73

	    

Data files

None.

Notes

None.

References

	I.L. Hofacker., et al.,(1994) Fast Folding and Comparison of RNA Secondary
	Structures, Monatshefte fur Chemie, 125, 167-188.

	M, Zuker., and P, Stiegler.,(1981) Optimal computer folding of large RNA
	sequences using thermodynamic and auxiliary information,
	Nucleic Acids Research, 9, 133-148.

	J.S, McCaskill(1990) The equilibrium partition function and base pair binding
	probabilities for RNA secondary structures, Biopolymers, 29, 1105-1119.
      

Warnings

None.

Diagnostic Error Messages

None.

Exit status

It always exits with a status of 0.

Known bugs

None.

See also

Program name Description
kcentroidfold Predicts RNA 2D structure using CentroidFold
seqret Reads and writes (returns) sequences

Author(s)

Kazuki Oshita (cory @ g-language.org)
Institute for Advanced Biosciences, Keio University
252-8520 Japan

History

2010 - Written by Kazuki Oshita
Feb 2013 - Update document by Kazuki Oshita

Target users

This program is intended to be used by everyone and everything, from naive users to embedded scripts.

Comments

None.