kcentroidfold

 

Function

Predicts RNA 2D structure using CentroidFold

Description

kcentroidfold predicts an RNA 2D structure from given RNA sequence utilizing CentroidFold. CentroidFold is based on the gamma-centroid estimator for high-dimensional discrete spaces.

kcentroidfold utilizes CentroidFold Web Server provided by ncRNA.org. Original web-service is located at the following URL:

http://www.ncrna.org/centroidfold/

This tools is a subset of Keio Bioinformatics Web Service (KBWS) package, which contains interfaces to bioinformatics web services through a proxy server at Keio University. kcentroidfold is thus an interface of "runCentroidFold" method included in KBWS SOAP service.
This method can be alternatively accessed directly from programming languages as SOAP web service. Please refer to the KBWS online documentations http://www.g-language.org/kbws/ for more information.

Usage


   Here is a sample session with kcentroidfold

% kcentroidfold
RNA 2D structure prediction from an RNA sequence using CentroidFold
Input (gapped) sequence(s): test.fasta
Output image file name [kcentroidfold.png]:
Output file [55-110.centroidfold]:

% cat 55-110.centroidfold
>M33000.1/55-110
ACGCUGUCUGUACUUGUAUCAGUACACUGACGAGUCCCUAAAGGACGAAACAGCGC
.(((((((((((((.(...)))))))..).(..((((.....)))))..)))))).

% ls kcentroidfold.png
kcentroidfold.png

	    

Command line arguments

Qualifier Type Description Allowed values Default
Standard (Mandatory) qualifiers
[-seqall]
(Parameter 1)
seqall (Gapped) sequence(s) filename and optional format, or reference (input USA) Readable sequence(s) 2
[-outfile]
(Parameter 2)
outfile Output file name Output file <*>.kcentroidfold
[-goutfile]
(Parameter 3)
string Output image file name String kcentroid.png
Additional (Optional) qualifiers
-engine string specify the inference engine 'CONTRAfold', 'McCaskill', 'pfold' or 'AUX' CONTRAfold
-gamma integer weight of base pairs (2^-5 ~ 2^10) Any integer value 4
Advanced (Unprompted) qualifiers
(none)

Input file format

kcentroidfold can use any genome sequence data that seqret can read.

Output file format

kcentroidfold outputs "Seq/Fold information" and "graph result". "Seq/Fold information" is general CentroidFold output file. "graph result" is an URL about image file of predicted 2D structure.

Data files

None.

Notes

None.

References

	Kengo, Sato., et al.,(2009) CentroidFold: a web server for RNA secondary
	structure prediction, Nucleic Acids Research, 37, 277-280.
	Michiaki, Hamada., et al.,(2009) Predictions of RNA secondary structure
	using generalized centroid estimators, Bioinformatics, 25(4), 465-473. 
      

Warnings

None.

Diagnostic Error Messages

None.

Exit status

It always exits with a status of 0.

Known bugs

None.

See also

Program name Description
seqret Reads and writes (returns) sequences
krnafold Predicts secondary structure of single starnd RNA or DNA using RNAfold

Author(s)

Kazuki Oshita (cory @ g-language.org)
Institute for Advanced Biosciences, Keio University
252-8520 Japan

History

2009 - Written by Kazuki Oshita
Feb 2013 - Update document by Kazuki Oshita

Target users

This program is intended to be used by everyone and everything, from naive users to embedded scripts.

Comments