|
|
kcentroidfold |
kcentroidfold utilizes CentroidFold Web Server provided by ncRNA.org. Original web-service is located at the following URL:
http://www.ncrna.org/centroidfold/
This tools is a subset of Keio Bioinformatics Web Service (KBWS) package, which contains interfaces to bioinformatics web services through a proxy server at Keio University. kcentroidfold is thus an interface of "runCentroidFold" method included in KBWS SOAP service. This method can be alternatively accessed directly from programming languages as SOAP web service. Please refer to the KBWS online documentations http://soap.g-language.org/kbws/ for more information.
Here is a sample session with kcentroidfold % kcentroidfold Predicts RNA 2D structure using CentroidFold Input (gapped) sequence(s): test.fasta Output file [55-110.centroidfold]: Jobid: kbws_12547145 *********** http://soap.g-language.org/alis/result/12547145.png >M33000.1/55-110 ACGCUGUCUGUACUUGUAUCAGUACACUGACGAGUCCCUAAAGGACGAAACAGCGC .(((((((((((((.(...)))))))..).(..((((.....)))))..)))))). |
| Qualifier | Type | Description | Allowed values | Default |
|---|---|---|---|---|
| Standard (Mandatory) qualifiers | ||||
| [-seqall] (Parameter 1) |
seqall | (Gapped) sequence(s) filename and optional format, or reference (input USA) | Readable sequence(s) | 2 |
| [-outfile] (Parameter 2) |
outfile | Output file name | Output file | <*>.kcentroidfold |
| Additional (Optional) qualifiers | ||||
| -model | string | information about this parameter | Any string | |
| -gamma | integer | information about this parameter | Any integer value | 1024 |
| Advanced (Unprompted) qualifiers | ||||
| (none) | ||||
Kengo, Sato., et al.,(2009) CentroidFold: a web server for RNA secondary
structure prediction, Nucleic Acids Research, 37, 277-280.
Michiaki, Hamada., et al.,(2009) Predictions of RNA secondary structure
using generalized centroid estimators, Bioinformatics, 25(4), 465-473.
| Program name | Description |
|---|---|
| seqret | Reads and writes (returns) sequences |